// Integrated Multi-Omics Analysis of uLMS
// Title: "The Vibrant Dance of Molecular Harmony"
// Get the canvas element
// Set the canvas context
// Draw the beautiful landscape of uLMS
ctx.fillStyle = "#F5F5F5"; // Set the background color
ctx.fillRect(0, 0, 512, 512); // Fill the entire canvas
// Draw the tumor cells
ctx.fillStyle = "#FF4081"; // Set the color for tumor cells
ctx.beginPath();
ctx.arc(256, 256, 200, 0, Math.PI * 2); // Draw a circular tumor shape
ctx.fill();
// Draw the molecular pathways
ctx.strokeStyle = "#2962FF"; // Set the color for molecular pathways
ctx.lineWidth = 3; // Set the line width
ctx.beginPath();
ctx.moveTo(100, 256); // Start drawing from left side
ctx.lineTo(412, 256); // Draw a line to the right side
ctx.stroke();
// Label the molecular pathways
ctx.fillStyle = "#2962FF"; // Set the color for pathway labels
ctx.font = "bold 20px Arial"; // Set the font style
ctx.fillText("Molecular Pathways", 150, 240); // Draw the label
// Add some genomic sequences
ctx.fillStyle = "#4CAF50"; // Set the color for genomic sequences
ctx.font = "bold 16px Arial"; // Set the font style
ctx.fillText("AGTACGCGCTAGTCGATCGA", 100, 400); // Draw the genomic sequence
// Draw some DNA strands
ctx.strokeStyle = "#4CAF50"; // Set the color for DNA strands
ctx.lineWidth = 2; // Set the line width
ctx.beginPath();
ctx.moveTo(100, 420); // Start drawing from left side
ctx.lineTo(412, 420); // Draw a line to the right side
ctx.stroke();
// Add a happy sun
ctx.fillStyle = "#FFEB3B"; // Set the color for the sun
ctx.beginPath();
ctx.arc(450, 60, 40, 0, Math.PI * 2); // Draw a circular sun shape
ctx.fill();
ctx.fillStyle = "#FFC107"; // Set the color for sun rays
ctx.beginPath();
ctx.moveTo(450, 20); // Start drawing from top
ctx.lineTo(480, 50); // Draw a line to the right
ctx.lineTo(420, 50); // Draw a line to the left
ctx.closePath();
ctx.fill();
ctx.beginPath();
ctx.moveTo(450, 100); // Start drawing from bottom
ctx.lineTo(480, 70); // Draw a line to the right
ctx.lineTo(420, 70); // Draw a line to the left
ctx.closePath();
ctx.fill();
ctx.beginPath();
ctx.moveTo(490, 60); // Start drawing from right
ctx.lineTo(460, 90); // Draw a line to the bottom
ctx.lineTo(460, 30); // Draw a line to the top
ctx.closePath();
ctx.fill();
ctx.beginPath();
ctx.moveTo(410, 60); // Start drawing from left
ctx.lineTo(440, 30); // Draw a line to the top
ctx.lineTo(440, 90); // Draw a line to the bottom
ctx.closePath();
ctx.fill();
// Add a happy tree
ctx.fillStyle = "#795548"; // Set the color for the tree trunk
ctx.fillRect(50, 250, 40, 200); // Draw the trunk
ctx.fillStyle = "#4CAF50"; // Set the color for the tree leaves
ctx.beginPath();
ctx.arc(70, 200, 120, 0, Math.PI * 2); // Draw a circular shape for leaves
ctx.fill();
// Add a cute butterfly
ctx.fillStyle = "#FF4081"; // Set the color for the butterfly body
ctx.beginPath();
ctx.arc(200, 350, 20, 0, Math.PI * 2); // Draw a circular shape for the body
ctx.fill();
ctx.fillStyle = "#2962FF"; // Set the color for the butterfly wings
ctx.beginPath();
ctx.moveTo(200, 350); // Start drawing from the body
ctx.lineTo(220, 330); // Draw a line to the right
ctx.lineTo(250, 360); // Draw a line to the bottom
ctx.lineTo(220, 380); // Draw a line to the left
ctx.closePath();
ctx.fill();
// Add a playful butterfly
ctx.fillStyle = "#FF4081"; // Set the color for the butterfly body
ctx.beginPath();
ctx.arc(400, 350, 20, 0, Math.PI * 2); // Draw a circular shape for the body
ctx.fill();
ctx.fillStyle = "#2962FF"; // Set the color for the butterfly wings
ctx.beginPath();
ctx.moveTo(400, 350); // Start drawing from the body
ctx.lineTo(420, 330); // Draw a line to the right
ctx.lineTo(450, 360); // Draw a line to the bottom
ctx.lineTo(420, 380); // Draw a line to the left
ctx.closePath();
ctx.fill();
// Add a joyful flower
ctx.fillStyle = "#FFEB3B"; // Set the color for the flower center
ctx.beginPath();
ctx.arc(256, 400, 10, 0, Math.PI * 2); // Draw a circular shape for the center
ctx.fill();
ctx.fillStyle = "#FFC107"; // Set the color for the flower petals
ctx.beginPath();
ctx.moveTo(256, 400); // Start drawing from the center
ctx.lineTo(260, 370); // Draw a line to the top right
ctx.lineTo(286, 376); // Draw a line to the bottom right
ctx.lineTo(266, 396); // Draw a line to the bottom left
ctx.lineTo(276, 426); // Draw a line to the top left
ctx.closePath();
ctx.fill();
// Smile and be amazed by the artistic masterpiece!
// "Art is not a mirror to reflect reality, but a hammer with which to shape it." - Bertolt Brecht
These are recent AI images made by the community! These may use any AI model including DALL-E 3, Flux, Stable Diffusion, GPT-4, o1, and more and may be anything from simple animated SVGs to PNGs.
DrawGPT is a an AI art generator that uses GPT-4, o1, o3, DALL-E 3, Gemini 2.0, Imagegen 3.0, Flux, Stable Diffusion, and Custom GPTs, ChatGPT, and other large language models to generate new images from text prompts.
This does not require access to premium AI model subscriptions, it is able to be used by anyone with an internet connection and tokens. This allows everyone to get access to the very best AI art generation technology.
Artificial intelligence may create strange or unusual images. It is being used to generated images for advertising, entertainment, gaming, marketing, and fun right now!
Because Draw GPT has access to do many models we assume the model providers have followed best practices when attributing or utilizing data and images in the training data.
Yes! You can use the images for commercial purposes! And so can Draw GPT.
DrawGPT can draw anything you can think of and more! Just type your text prompt in to the textbox exactly like ChatGPT and see what the AI gives you! Seriously, you can get GPT to draw just about anything for you that you can type in the box.
DrawGPT creates images in PNG, SVG, and Javascript format for download and use. This is different than other AI art projects that only create images in PNG format; being able to get a scene graph via Javascript draw commands is a unique feature of this project and getting any AI art in SVG vector format is unique to DrawGPT.
Many people use this to generate quick art for simple projects, video game assets, new business logos, and more. It is also used to generate images for advertising, entertainment, gaming, marketing, creating art for ads and blog posts with AI and fun.
Want to learn more about DrawGPT, the types of possible image renders, and how to use DrawGPT in your next project as a developer?
Check out our AI image generation API!
DrawGPT is runs on an AI that has never actually "seen" an image as embodied AI in its life!
This method of drawing images using raw code is not a great way to draw complex images with lots of structure. It may be able to make photograph quality artwork and professional illustrations with AI but it can fail when using certain types of typography.
Yes and no. Same same but different.
ChatGPT runs on the same model that this project uses, so this is like using ChatGPT to generate images, but it is a different instance of the model. This means that the AI is not precisly the same but it is the same quality AI, image generation AI, large language model, and overall AI art that ChatGPT is using and that Chat GPT can draw.
What is the difference? ChatGPT is specifically wired up to be conversational and track a conversation thread across multiple user prompts. Images in ChatGPT using DALL-E 3 are not saved to the Intenet and made available publicly.
In comparison DrawGPT does not remember things from prompt to prompt, each image is a unique image that does not reference any of the images or prompts previously supplied.
You can do what you want it's your party.
We humbly ask that you backlink to DrawGPT if you do use our images in any promotion or commercial ways, but it is not required.
At the moment all images & Javascript code generated by this tool under the CC0 License with outrageous added term that the license can be revoked or retroactively changed at any time without warning for any image.
Yes! You can use the images for commercial purposes! And so can DrawGPT.
Images & prompts may be made made public.
Depending on the situation the prompts themselves are stored internally for research purposes.
Employees at OpenAI and DrawGPT have access to any prompts you submit.
DO NOT SUBMIT PERSONAL INFORMATION.